You have no items in your shopping cart.
Cart summary
CXCL3
Catalog Number: orb527571
| Catalog Number | orb527571 |
|---|---|
| Category | Tools |
| Description | CXCL3 |
| DNA Notes | pENTR223.1 |
| atggcccacgccacgctctccgccgcccccagcaatccccggctcctgcgggtggcgctgctgctcctgctcctggtggccgccagccggcgcgcagcaggagcgtccgtggtcactgaactgcgctgccagtgcttgcagacactgcagggaattcacctcaagaacatccaaagtgtgaatgtaaggtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggaagaaagcttgtctcaaccccgcatcccccatggttcagaaaatcatcgaaaagatactgaacaaggggagcaccaactga | |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC016308 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 1
Human CXCL3 protein (Active) [orb359049]
> 97% as determined by SDS-PAGE and HPLC.
7.9 kDa
E.Coli
100 μg, 500 μg, 10 μg - Item 1 of 1
Mouse CXCL3 protein (Active) [orb359092]
> 97% as determined by SDS-PAGE and HPLC.
7.9 kDa
E.Coli
10 μg, 500 μg, 100 μg - Item 1 of 1
Rat CXCL3 protein (Active) [orb359123]
> 96% as determined by SDS-PAGE and HPLC.
7.8 kDa
E.Coli
100 μg, 500 μg, 10 μg - Item 1 of 1
Rat CXCL3 protein (Active) [orb359124]
> 96% as determined by SDS-PAGE and HPLC.
7.6 kDa
E.Coli
10 μg, 500 μg, 100 μg - Item 1 of 4
Human CXCL3 (N-6His) Protein [orb1471728]
Greater than 95% as determined by reducing SDS-PAGE.
10.1 KDa
Mammalian
10 μg, 50 μg
