You have no items in your shopping cart.
Cart summary
CXCL10
Catalog Number: orb527542
| Catalog Number | orb527542 |
|---|---|
| Category | Tools |
| Description | CXCL10 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC010954 |
| atgaatcaaactgccattctgatttgctgccttatctttctgactctaagtggcattcaaggagtacctctctctagaactgtacgctgtacctgcatcagcattagtaatcaacctgttaatccaaggtctttagaaaaacttgaaattattcctgcaagccaattttgtccacgtgttgagatcattgctacaatgaaaaagaagggtgagaagagatgtctgaatccagaatcgaaggccatcaagaatttactgaaagcagttagcaaggaaaggtctaaaagatctccttaa | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
- Item 1 of 3
CXCL10/IP10 Rabbit Polyclonal Antibody [orb10277]
FC, IF, IHC-Fr, IHC-P
Human, Rat
Human, Mouse, Rat
Rabbit
Polyclonal
Unconjugated
100 μl, 50 μl, 200 μl - Item 1 of 5
- Item 1 of 1
Recombinant Rat gamma-Interferon Inducible Protein 10/CXCL10 [orb1906001]
> 95 % by SDS-PAGE and HPLC analyses.
Approximately 8.7 kDa, a single non-glycosylated polypeptide chain containing 77 amino acids.
Escherichia coli
5 μg, 100 μg, 500 μg - Item 1 of 1
Recombinant Murine gamma-Interferon Inducible Protein 10/CXCL10 [orb1906034]
> 97 % by SDS-PAGE and HPLC analyses.
Approximately 8.7 kDa, a single non-glycosylated polypeptide chain containing 77 amino acids.
Escherichia coli
100 μg, 500 μg, 5 μg - Item 1 of 1
Recombinant Rhesus Macaque gamma-Interferon Inducible Protein 10/CXCL10 [orb1906045]
> 97 % by SDS-PAGE and HPLC analyses.
Approximately 8.7 kDa, a single non-glycosylated polypeptide chain containing 77 amino acids.
Escherichia coli
500 μg, 5 μg, 100 μg
