You have no items in your shopping cart.
Cart summary
CXCL1
Catalog Number: orb527570
| Catalog Number | orb527570 |
|---|---|
| Category | Tools |
| Description | CXCL1 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC011976 |
| atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaagtgtgaacgtgaagtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggcggaaagcttgcctcaatcctgcatcccccatagttaagaaaatcatcgaaaagatgctgaacagtgacaaatccaactga | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
- Item 1 of 3
GRO Alpha Rabbit Polyclonal Antibody [orb183809]
IF, IHC-Fr, IHC-P
Mouse, Rat
Human
Rabbit
Polyclonal
Unconjugated
100 μl, 50 μl, 200 μl - Item 1 of 1
Recombinant Murine KC/CXCL1 [orb1906041]
> 97 % by SDS-PAGE and HPLC analyses.
Approximately 7.8 kDa, a single non-glycosylated polypeptide chain containing 72 amino acid residues.
Escherichia coli
5 μg, 100 μg, 500 μg - Item 1 of 1
Recombinant Human Growth Regulated Protein-alpha/CXCL1 [orb1906091]
> 97 % by SDS-PAGE and HPLC analyses.
Approximately 7.9 kDa, a single non-glycosylated polypeptide chain containing 73 amino acids.
Escherichia coli
500 μg, 5 μg, 100 μg Recombinant Rat Cytokine-induced Neutrophil Chemoattractant 1/CXCL1 [orb1906007]
> 97 % by SDS-PAGE and HPLC analyses.
Approximately 7.8 kDa, a single, non-glycosylated polypeptide chain containing 72 amino acids.
Escherichia coli
5 μg, 100 μg, 500 μg
