You have no items in your shopping cart.
Cart summary
CNTF
Catalog Number: orb529210
| Catalog Number | orb529210 |
|---|---|
| Category | Tools |
| Description | CNTF |
| UniProt ID | BC068030 |
| Protein Sequence | atggctttcacagagcattcaccgctgacccctcaccgtcgggacctctgtagccgctctatctggctagcaaggaagattcgttcagacctgactgctcttacggaatcctatgtgaagcatcagggcctgaacaagaacatcaacctggactctgcggatgggatgccagtggcaagcactgatcagtggagtgagctgaccgaggcagagcgactccaagagaaccttcaagcttatcgtaccttccatgttttgttggccaggctcttagaagaccagcaggtgcattttaccccaaccgaaggtgacttccatcaagctatacatacccttcttctccaagtcgctgcctttgcataccagatagaggagttaatgatactcctggaatacaagatcccccgcaatgaggctgatgggatgcctattaatgttggagatggtggtctctttgagaagaagctgtggggcctaaaggtgctgcaggagctttcacagtggacagtaaggtccatccatgaccttcgtttcatttcttctcatcagactgggatcccagcacgtgggagccattatattgctaacaacaagaaaatgtag |
| Note | For research use only |
| Application notes | Vector: pUC |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 6
- Item 1 of 4
- Item 1 of 5
- Item 1 of 1
Human IL-11 R alpha Protein [orb1149284]
Unconjugated
95%
39.6 kDa
Human IL-11 R alpha, His Tag (orb1149284) is expressed from human 293 cells (HEK293). It contains AA Ser 24 - Ala 370 (Accession # Q14626-1).
100 μg, 1 mg - Item 1 of 1
Mouse IL-11 R alpha Protein [orb1496203]
Unconjugated
90%
38.0 kDa
Mouse IL-11 R alpha, His Tag (orb1496203) is expressed from human 293 cells (HEK293). It contains AA Cys 26 - Gln 367 (Accession # Q64385-1).
1 mg, 100 μg
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars