You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527497 |
---|---|
Category | Tools |
Description | CHP |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC008373 |
atggagtctcactctgtcacccaggctggagtgcagtggcgtgatcttggctcactgcaacctctgcctcctgggttcaagcaattctcccacctcagcctcccaagtagctgggattacagacgtgtgccaccatacctgggtaatttttgcatttttagtggagagggagtttcaccatgttggccaggttggtcttga | |
DNA Notes | pENTR223.1 |
Note | For research use only |
Greater than 90% as determined by SDS-PAGE. | |
16.1 kDa | |
Yeast |
ELISA, IF, IHC, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
ICC, IHC-P, WB | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
IHC, WB | |
Bovine, Canine, Equine, Guinea pig, Mouse, Rabbit, Rat, Zebrafish | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |