You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527673 |
---|---|
Category | Tools |
Description | CHCHD2 |
DNA Notes | pENTR223.1 |
atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccaggtctgatggcccagatggcaaccactgcagctggcgtggctgtgggctctgctgtggggcacacattgggtcacgccattactgggggcttcagtggaggaagtaatgctgagcctgcgaggcctgacatcacttaccaggagcctcagggaacccagccagcacagcagcagcagccttgcctctatgagatcaaacagtttctggagtgtgcccagaaccagggtgacatcaagctctgtgagggtttcaatgaggtgctgaaacagtgccgacttgcaaacggattggcctaa | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC003079 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
IF, IH, WB | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |