You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb603864 |
---|---|
Category | Tools |
Description | BOLA1 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC063405 |
atgctgagtgggcggctggtcctgggtctggtctccatggctggccgcgtttgtttgtgccagggcagcgcgggatccggggccatcggtccggtggaggccgccattcgcacgaagttggaggaggccctgagccccgaggtgctagagcttcgcaacgagagcggtggccacgcggtcccgcctggcagtgagactcacttccgcgtggctgtggtgagctctcgtttcgagggactgagccccctacaacgacaccggctggtccacgcagcgctggccgaggagctgggaggtccggtccatgcgctggccatccaggcacggacccccgcccagtggagagagaactctcagctggacactagccccccatgcctgggtgggaacaagaaaactctaggaaccccctga | |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
Note | For research use only |
IHC, WB | |
Bovine, Canine, Guinea pig, Mouse, Porcine, Rabbit, Rat, Zebrafish | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
Greater than 90% as determined by SDS-PAGE. | |
16.3 kDa | |
Yeast |
ELISA, IF, IHC, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
WB | |
Human, Rabbit, Rat | |
Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |