You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb595504 |
---|---|
Category | Tools |
Description | BET1 |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
atgaggcgtgcaggcctgggtgaaggagtacctcctggcaactatgggaactatggctatgctaatagtgggtatagtgcctgtgaagaagaaaatgagaggctcactgaaagtctgagaagcaaagtaactgctataaaatctctttccattgaaataggccatgaagttaaaacccagaataaattattagctgaaatggattcacaatttgattccacaactggatttctaggtaaaactatgggcaaactgaagattttatccagagggagccaaacaaagctgctgtgctatatgatgctgttttctttatttgtcttttttatcatttattggattattaaactgaggtga | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
Hazard Information | Non-Toxic |
UniProt ID | BC000899 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |