You have no items in your shopping cart.
Page Not Found
Cart summary
BET1
Catalog Number: orb595504
| Catalog Number | orb595504 |
|---|---|
| Category | Tools |
| Description | BET1 |
| DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| atgaggcgtgcaggcctgggtgaaggagtacctcctggcaactatgggaactatggctatgctaatagtgggtatagtgcctgtgaagaagaaaatgagaggctcactgaaagtctgagaagcaaagtaactgctataaaatctctttccattgaaataggccatgaagttaaaacccagaataaattattagctgaaatggattcacaatttgattccacaactggatttctaggtaaaactatgggcaaactgaagattttatccagagggagccaaacaaagctgctgtgctatatgatgctgttttctttatttgtcttttttatcatttattggattattaaactgaggtga | |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| Hazard Information | Non-Toxic |
| UniProt ID | BC000899 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
